DNA transcription and mRNA processing
10:25
Khan AcademySal Khan
DNA transcription and mRNA processing
Transcription involves rewriting genetic information from DNA to mRNA, with RNA polymerase playing a crucial role. In eukaryotic cells, DNA to mRNA transcription occurs within the nucleus, producing pre-mRNA. This pre-mRNA undergoes processing, including the addition of a 5' cap, a poly-A tail, and splicing out introns, resulting in mature mRNA ...
Jun 7, 2016
Related Products
DNA/RNA Transcription
Transcription Factors
Immature RNA Transcript
#RNA Transcription Animation
3D Animations - Transcription & Translation: Transcription (Basic) - CSHL DNA Learning Center
3D Animations - Transcription & Translation: Transcription (Basic) - CSHL DNA Learning Center
cshl.eduAug 24, 2019
3D Animations - Transcription & Translation: RNA Splicing - CSHL DNA Learning Center
3D Animations - Transcription & Translation: RNA Splicing - CSHL DNA Learning Center
cshl.eduAug 26, 2019
Top videos
Answered: The primary RNA transcript of the chicken ovalbumin gene is 7700 nucleotides long, but the mature mRNA that is translated on the ribosome is 1872 nucleotides… | bartleby
Answered: The primary RNA transcript of the chicken ovalbumin gene is 7700 nucleotides long, but the mature mRNA that is translated on the ribosome is 1872 nucleotides… | bartleby
bartleby.com
Dec 15, 2021
mRNA Transcription Process & Phases
10:59
mRNA Transcription Process & Phases
Study.comApril Koch
268K viewsJul 8, 2014
RNA Polymerase (a) How long would it take for the E . coli RNA polymerase to synthesize the primary transcript for the E. coli genes encoding the enzymes for lactose metabolism, the 5,300 bp lac operon (considered in Chapter 28 )? (b) How far along the DNA would the transcription "bubble" formed by RNA polymerase move in 10 seconds? | Numerade
RNA Polymerase (a) How long would it take for the E . coli RNA polymerase to synthesize the primary transcript for the E. coli genes encoding the enzymes for lactose metabolism, the 5,300 bp lac operon (considered in Chapter 28 )? (b) How far along the DNA would the transcription "bubble" formed by RNA polymerase move in 10 seconds? | Numerade
numerade.com
Feb 11, 2024
RNA Transcription and Translation
The 5 Steps of Transcription From DNA to RNA
The 5 Steps of Transcription From DNA to RNA
thoughtco.com
Aug 26, 2024
An Introduction to DNA Transcription
An Introduction to DNA Transcription
thoughtco.com
Dec 10, 2021
Process of Transcription - Definition, Stages, RNA Polymerase
Process of Transcription - Definition, Stages, RNA Polymerase
careers360.com
Aug 17, 2024
Answered: The primary RNA transcript of the chicken ovalbumin gene is 7700 nucleotides long, but the mature mRNA that is translated on the ribosome is 1872 nucleotides… | bartleby
Answered: The primary RNA transcript of the chicken ovalbumi…
Dec 15, 2021
bartleby.com
mRNA Transcription Process & Phases
10:59
mRNA Transcription Process & Phases
268K viewsJul 8, 2014
Study.comApril Koch
RNA Polymerase (a) How long would it take for the E . coli RNA polymerase to synthesize the primary transcript for the E. coli genes encoding the enzymes for lactose metabolism, the 5,300 bp lac operon (considered in Chapter 28 )? (b) How far along the DNA would the transcription "bubble" formed by RNA polymerase move in 10 seconds? | Numerade
RNA Polymerase (a) How long would it take for the E . coli RNA p…
Feb 11, 2024
numerade.com
6K views · 281 reactions | Characterize transcript diversity, find out how gene isoforms translate into functional effects, and more with full-length transcript sequencing—powered by PacBio highly accurate long reads (HiFi reads)! Click to learn more. | PacBio | Facebook
0:09
6K views · 281 reactions | Characterize transcript diversity, fi…
54.9K views2 weeks ago
FacebookPacBio
How is the primary transcript produced by a prokaryotic cell di... | Filo
How is the primary transcript produced by a prokaryotic cell di..…
6K views8 months ago
askfilo.com
Answered: Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAG GCTATATTCACGTGGTACGCTA 3'… | bartleby
Answered: Question 7. What is the sequence of the primary transcrip…
Apr 12, 2023
bartleby.com
The 5 Steps of Transcription From DNA to RNA
The 5 Steps of Transcription From DNA to RNA
Aug 26, 2024
thoughtco.com
7:34
DNA Polymerase & RNA Primase | Functions & End Products
190K viewsDec 10, 2012
Study.comMaggie Anderson
14.5: RNA Processing in Eukaryotes
Dec 18, 2021
libretexts.org
Understanding Transcription: A Deep Dive into DNA and RNA Proc…
166.8K viewsFeb 25, 2023
TikToka_biology_teacher
14:38
RNA Protein Synthesis
254.1K viewsJan 7, 2013
YouTubeMeredith Kersting
8:45
Eukaryotic Transcription
720.5K viewsSep 5, 2019
YouTubeQuick Biochemistry Basics
3:04
mRNA Translation (Advanced)
1.4M viewsMar 22, 2010
YouTubeDNA Learning Center
1:24:09
BIOL2416 Chapter 10 - Transcription and RNA Processing
7.8K viewsMay 23, 2021
YouTubeDr. D Explains Stuff
12:44
Protein Synthesis: Translation
195K viewsFeb 18, 2021
YouTubeMiss Angler
10:39
DNA Translation Made Easy
821.5K viewsMay 15, 2018
YouTubeMEDSimplified
2:51
Alternative Splicing / Alternative Processing (Eukaryotes)
183.6K viewsDec 9, 2013
YouTubeMoof University
0:55
Post-Transcriptional modification mRNA | RNA Processing
100.4K viewsMar 14, 2014
YouTubeBiotech Review
23:06
Transcription (DNA to RNA)
2K viewsDec 14, 2019
YouTubeEducable SG
5:26
Transcription Elongation in Eukaryotes
104.8K viewsMay 20, 2020
YouTubeHussain Biology
2:28
How do mRNA COVID-19 vaccines work?
421.9K viewsMar 10, 2021
YouTubePBS NewsHour
4:01
Transcription Initiation in Eukaryotes
297.9K viewsMay 13, 2019
YouTubeHussain Biology
1:56
DNA Transcription (Advanced Detail) | HHMI BioInteractive Video
85.7K viewsOct 19, 2015
YouTubebiointeractive
4:16
Transcription Termination in Prokaryotes
231.4K viewsApr 29, 2019
YouTubeHussain Biology
7:49
Transcription Made Easy- From DNA to RNA (2019)
1.5M viewsMar 10, 2018
YouTubeMEDSimplified
3:17
Overview of mRNA Processing in Eukaryotes
130.4K viewsJun 30, 2020
YouTubeHussain Biology
1:22
mRNA - Protein Synthesis - animated
1.2K viewsApr 8, 2021
YouTubeEngineer Passion
17:22
Transcription In Prokaryotes || Transcription
26.6K viewsMay 26, 2020
YouTubeBiochemistry Basics by Dr Amit
7:55
DNA Transcription Made EASY | Part 1: Initiation 🐣
306.5K viewsJan 13, 2016
YouTubePremedHQ Science Academy
See more videos
Static thumbnail place holder